1957 LONGINES 23ZS STAINLESS STEEL CASE AND BACK 1541 69951 11644289 GOOD RUNNER / PMAUCTION часы Breitling uk

1957 LONGINES 23ZS STAINLESS STEEL CASE AND BACK 1541 69951 11644289 GOOD RUNNER

[ ID: 119935 ]
Quantity
1
Status
Open
Listing viewed 111 times Listing watched by 5 users
Seller
mass6161 (100 )
Registered Since
04.01.2014 10:58:38
Feedback
100%
View Other Items

Sales History

The listing has not been sold.

Beautiful 1957 "circa" longines 23zs stainless steel case and back.
100% original and genuine.
Case back is signed longines fab. swiss made 1541 6995 1 acier inoxidable.
Movement is signed longines swiss made 17 jewels 11644289 23zs.
Good runner keep time very well but maybe need a services.

Lug to lug: 43,1mm

Diameter without crown: 34,9mm.

Diameter with chrown: 37,8mm

Thichness: 10,0mm

----------------------------------------------------------------------------------------------------------------------------------------

I'm not a professional seller, i'm a watch collector so usually sell items from my personal collection to collect money for other watch.
I also accept to swap watch with other watch.
Because I have a work, I cannot check every day my page, so before bidding or buy, contact me to know if item is still available.

Year
-
Brand
Longines
Model
-
Reference
-
Type
-
Material
Stainless Steel
Dial
Original
Case
Stainless Steel
Case Back
Stainless Steel
Movement
Manual
Calibre
23zs
Bracelet
-
Clasp
-
Strap
-
Buckle
-
Box
-
Guarantee
-
Lug To Lug
43,1mm "circa"
Diameter Without Crown
34,9mm "circa"
Diameter With Crown
37,8mm "circa"
Thickness
10,0mm "circa"
ID
-
Payment Methods
PayPal, Wire Transfer
Returns Accepted
Yes
Returns Policy
RETURN AVAILABLE
Item Location
10034, Torino, Italy
Ships To
Worldwide

Postage Calculator

Select Country
Zip/Post Code
Quantity
Pick-ups
Buyer can pick-up
Insurance
Free
Shipping Instructions
We ship this item via registered airmail worldwide at a flat rate of 15 Euro / 20 euro. For payment, we accept a wire or a paypal. Si spedisce al in tutto il mondo con raccomandata, al prezzo di 10 / 15 Euro flat. (dentro Italia con Racc1 al prezzo di 6 Euro) . Per pagamento si accetta bonifico, paypal, postepay.

Public Questions

There are no messages posted.
You need to be logged in to ask the seller a question.
Click here to login

часы Breitling uk

ساعات لونجين للرجال
replica rolex klokker for menn
beste luxe replica horloges
オメガ時計 Coment

List database

# MySQL hash MySQL password 261,330,001 *198529A51EDD623EBD2669F9A494ECAF4E9C7398 WARDATIAHMAD 261,330,002 *198C80A3A1CAF0254D1C19725239B20096B88EA0 WARDCORS3 261,330,003 *198758646D83257CAE38F4116232B98D1011BD33 328961 deyimyerindeyse"birnesilonunlabUyUdU" 261,330,004 *19809809B9B72D5DE98FE451541DEA3C0ACBCBA3 4TESTBESTANDEN 261,330,005 *1986791D84E2B5FEAD43DBEF45EB158D6B6BD113 CLEAA 261,330,006 *198CC202BB7BBD9FFBBCA016BFA8C6B209FC6295 CLEMENTKACYNSKI 261,330,007 *19898EA7ED619B5A688E09D699657A9F7409056C 50ABIGAYLE 261,330,008 *1985820D55444C1479BF3B9BFBD24EC24C25C9F9 35DDAD30C9997ACA87DFDE8676501129284831B75F48EF45 261,330,009 *198CC27CA2630DF82F9F27DB926E45BCA3E3C52E CLNMR 261,330,010 *198862B59949C404263F9D906972D77843C975D5 51q 261,330,011 *1989CB5BB28DF660D4C9CAE92D78DFB520FC4123 3CHANCEATH 261,330,012 *1982594885057B6654503CF83DA3B33CEA4CE49A WENA.SALES.BRIONES 261,330,013 *19871DC1AE09DD388AF3878EA558CE47E729229C 3======D~0~O)O( 261,330,014 *19857FDDA6C61BF568E50E2F973E005D88A641CB CN6=N 261,330,015 *198E3E3E42B547BE15BEBBA75A9387F4AD4CA2D2 CNMU1 261,330,016 *19893F522A8F329036F24CB42EF62C99B00CD962 COCHLITE3 261,330,017 *198179F52BF68B1900B90E5398C3BFF889002A21 5BROWNSVOLLEYB 261,330,018 *1982B8E2D5C234EAC28B44B563D8954935B0FE50 3ILOVEBUNNY9 261,330,019 *1988730CDA74222AB861AF2F351CDF7D111293AE WESTON KELLIHER 261,330,020 *198F03953888F13979131406387AD659F50895DA COLLEGE)任教, 261,330,021 *198DA4DD0BFF8AC011C8FC194606841E2149B1C6 WIDGETS.INTHISCASE,ITWILLWORKIFYOUUSETHIS: 261,330,022 *198810369ADF0F133D8C1DC00F1B50AFE8EAA2A5 5FORTUUNEDS 261,330,023 *1980CBFC8D1326CFA4493A95A48E9B5DB3639B27 CONCERTO IN DO MAGGIORE, RV 450: I. ALLEGRO MOLTO 261,330,024 *198AE7D996FA49EBE499223B2EA1EC294FAD3436 449CHRIS 261,330,025 *198A9644359F6B03C82A18265742919278EF7A2D CoO. 261,330,026 *19892929FE6711A6FE53EBEB0068F618F5BC9AA9 5myconrad7 261,330,027 *198E21A37BEC5B513FA778D7B2640A5A65C0710A 4CLEAMEN 261,330,028 *1986AC7AF8B44218BE2A48CDE049884BC64B6A4A 4DIRTSVOL 261,330,029 *1983683EE5239BDE1C0F3485928840D6A831EA1A cortezgaul 261,330,030 *198176D1124283AAF8BE5E037099AA1B3719A5C8 4ESSATICNI 261,330,031 *19884D3C68D3C5AEFA51A436514D7CA6749547CB COULDN'T.TELL.THE.BODIES.APART 261,330,032 *1988FEA0396C9D4CAE2BE382C12A304461E7DE4B 5SEGASSIE 261,330,033 *1985F2F0E2E39CEFBE0B44E353535CDDA1F31885 5SPALKVERBAND 261,330,034 *1980CAAF9ADBF0DDE961563CC3142EFB59075D9F 5TARAMICH 261,330,035 *19816CE732E61984661B3737A7C2EF637DE39E33 5THETOOL 261,330,036 *19833716E02AE91AC5B0899D58E8FA67DCE521EF WILLY.POZZUOLI 261,330,037 *198BE9D0F5F59965E01BE35309A56ADE3560E5FD c,p9z 261,330,038 *1984922955FB58FFE6F1DE37D74400D9EABBEBED cpaey3dn7mbab 261,330,039 *1988618E273F6E6E7288D4B721A6E51185B45331 cpmcc@yeahnet 261,330,040 *198829F80817F9964927842EC5A1CE46561C8F05 5VYPLOUVAJI 261,330,041 *1981CF957B451B756AE87B0F0ABF25B434D2DE04 WINFORDSCORDINO 261,330,042 *1982F41F6129B849659A401685532C272E535123 WINGCY@CTIMAIL3.COM 261,330,043 *1983951D9BEFC7D28FFD1F46551734473CE352C1 c:\program-files\microsoft-visual-studio-90\common7\ide\microsoftvisualstudiowpfflavordll 261,330,044 *1980BEB1E041C69CE24BA504324B44A9B188F777 C:\Program-Files\Microsoft-Visual-Studio-90\VC\ce\crt\src\callocc 261,330,045 *198B812714C96DFD0DBE8993E190742CF4627483 63SAM089 261,330,046 *1983BFAA8EEFAE82190296B8988B88998F820BAA CR4MPEDNESS 261,330,047 *19823284CD94AF5418DEBE40E79473AC2184E8F7 4VOLVOCONNIE 261,330,048 *198377E550ED9641CEB8422861535FA7AEFF2A24 CRINNION1 261,330,049 *198150E69F9D0E0DE1699BED1443F5761AE2B34B 4ZEUQIRNEH 261,330,050 *19865A959C71E208293AEFC8AA8E9952C2A54029 WOSURO 261,330,051 *198CB3009CD886C7442B28E2A11ACC72D6CDD9F2 である。50話で総裁xからある人物の「息子」と言われており、そこから考えれば 261,330,052 *198B73BEF630A83CC1868348D18DDF4ED756D513 WU.CEJUN 261,330,053 *198790F468C1A2CC3FC4FB8DA7890A1F3F06D5C9 WU.DANGDAI@YEAH.NET 261,330,054 *198FFBA0A163965A602679C81AC08BAB0EF9FCAA WUPATRICKL@YNET.COM 261,330,055 *19876421DE380272621130254BB8D7F25DC777AC CSEMBALÓJÁT 261,330,056 *19898EE652DBCE870320E700F44AA9F47978535F 567SINCERE 261,330,057 *198B2D76B9B776F7C489ACC67D11F59720E074C3 ct=d! 261,330,058 *19869E0EE26E889795F0B7430E2B8B65576F51FF CTKIQBSW7 261,330,059 *1980F18FE35D391602422409C1D0BDE99680C19E CUIDANIELJ@EMAIL.COM.CN 261,330,060 *198096A8852B28A8C0642FDA765213E094E53481 WWWLEVINRUTGERSEDU 261,330,061 *1981F9AC76B6CF982478B5247EDFBDEED732A559 5BSWMOREROBSW 261,330,062 *19841CA8B3C5B33193EDBFBF493A7FFB664E21EF wwwnorthernsafetycom 261,330,063 *198ECFD9CAA1F33991528AFB9E3FAF9D21242118 WWWNTBBMEHU 261,330,064 *198276F759D37EBE38B54655CCE6398D4AE0FAAF 5BULLBERNARD 261,330,065 *198990A092615971F305D0071CC793A42AE23863 WWWVSESLAVRU 261,330,066 *198947DC0F15C4DD820266A6324C931B2308A6DE cutnh 261,330,067 *198926DB8F3F37C41E3A0A65C5A81985125C7F8D CV51Q 261,330,068 *1981F2F2D3E03638CE6FA87C9B675937DD46B076 6REDAARMOETTYN 261,330,069 *198DF069F2AEB33AB3A58DBDF1F13A68EE6C4FE2 XCBX@TOM.COM 261,330,070 *19865B1E75301AAF514E45FFC225280D55108FE1 6ROMANCA 261,330,071 *1984B2D582609564B44B7CAE58CF206F2CDED1E7 cwisconsin 261,330,072 *198A653A0A7C2D0C5BFFD483BFA33DC6E9D1B163 XIAOMICHAELU@CN21TH.COM 261,330,073 *1984D462010B1F0D44485BB0B244AF269899C71D xiaowang@mximisnetnet 261,330,074 *19890E2DB5595C50D550B15A43032ECA94ABA349 CY:F 261,330,075 *19862078992283276CAF7FDBCD3C21611CC75373 d1kn% 261,330,076 *19866B5E30C34FA3ED953F9B05D3327893CE2A4E 799857 ANARMYEXPLOSIVESEXPERT,CAPT 261,330,077 *198F990F66B9B9658D9C38C498A05C2DF9689A3E 7AFFUMICANDOCI 261,330,078 *198CB73D13A30DE5DE431E43180E1CFA5E3EE3EB 7ALICEMICHELL 261,330,079 *19854D7243C0EBBA654DAA3B2B78951BA23EF041 5SPAGNOLESCA 261,330,080 *198D3A84211E4B08D879B69205BF4F05D13BC763 yaminhowladar 261,330,081 *198BE4FD1D4E076C4295573B58D7A46DA3E5A951 7BOSTONIANO 261,330,082 *198508892CFD94E9FBA91CB33021F793E1AC3306 7BSWMOOIBSW 261,330,083 *198842F07DB93F2604E6B77DBDB2EBB6D62523AC 7BSWMRYANBSW 261,330,084 *1984BD8D8BC3848A71454BCFBA46A645A8741757 YANGWAWA@126COM 261,330,085 *1980CD5FC0BD7BFC80F825590568D17D2C34E05E D7E307AB-118A-3552-A64F-0465C95DE7E1 261,330,086 *198CD462597015D31DE04C757D09BC06FD4593D5 d$7iq 261,330,087 *1989ECEA54232847600395FD11AFCC92136DEFF6 yayıkağıl 261,330,088 *1984F46107860B2155FFC1A7558F1C19C1F1F9E0 YEARLYSEMINALING 261,330,089 *198329904F1A6C46C6AC2AE354DBB7DBA82A199D YEAUGUSTB@ZG169.NET 261,330,090 *1985AA8A2B6F3F0E6C16FEEB020BD29A3F752500 d9fy! 261,330,091 *1988617827613A6B486CE7BC470CFEA2C2636612 7DENARIATUM 261,330,092 *198A98886180B8FA107F9C4013062DBE2F4162FE daadnaw9 261,330,093 *19812FBFD40FFEF321BF46566422D20538BB1FF6 7ESAKOGU 261,330,094 *198E5DB48FCE3317E23C72A0FDDD5185E9BCB8B5 DALIANIDHING 261,330,095 *19852E2512B8F5FAC4DF85D19834DA1D5C2CADA6 DALLASSAMONS 261,330,096 *1982F7FF4F7828F97835B1D22E58D5FE389F26EC 7ilovelionel6 261,330,097 *198188476057DB3720348855D5DCCF267C251C3A DANILO.COMPANIE 261,330,098 *198926BA6F3E16CFBFB24926C6715D1861557E23 dantopper 261,330,099 *1982FF853ED68BE3A3395114B16D1134EA1D5A8C yovd 261,330,100 *19815D09BE088EFE8912FA0F785421EE50106D0E YTIREGEL7 261,330,101 *1983AB5DEDC71271B8D358A2C2A7FE586C49413D DARRELL.FERKOVICH 261,330,102 *198702E402AC1DD5196240F5A49823991F7D5B45 darrenbulldog 261,330,103 *198D1A04D7A8F4E84D5778D349E453391810A56D david-franklin-noble 261,330,104 *1980181C5679822BB67FD32149B83B36E508D135 david@psd.com 261,330,105 *198AED9C0B2D89A14E672CF43110FB464684AA55 DAVID.TENDICK 261,330,106 *1980F91DE66B88A055E109523A5C6702E62D7942 days? 261,330,107 *198A7B4D3BD167E4E517F9AA08CBB17974CAB8B5 YUVIVIANE@MAIL.CHINA.COM 261,330,108 *198EEE6DE067D6C211F20AF8B081599051BDAC09 6IAMMAILMAN5 261,330,109 *198827E0227A3432A95BE394E5D986E477FD22F3 7TIAEGAGNE 261,330,110 *198A6A90AFAF9D7F360D1F74B58EDAA9147EB1BD D$C4RDN9 261,330,111 *1980D6D4AC3E56B99069C52FD1220B8C95C2E9C4 d+%cb 261,330,112 *198D7621CF8009C20A86190BE6CA40AED8AD22B4 7UNPREORDAINED 261,330,113 *19818E4EE7778D4DACB1DB658B4E389E78517B76 ZACKSEMPOI 261,330,114 *19846B484EAC44689368771C671FAABEEB0AC951 zahnswart 261,330,115 *198B1B7F2424D33517BCCB0818ABF8FEEEA9F71B ZAIRI MELAN 261,330,116 *19806003EE25B6BE3200EA04DB959A076890202D zakiafusco 261,330,117 *198157BE3F318A9F0436E19C31404D198361E717 6PIANOBENJAMIN 261,330,118 *198EAC8CC2B410DBC23B4FDB676D519FA491497A DEANDRE.DONADO 261,330,119 *1980CD8465C48AE8F62210B82E6994B1ECB3244F 6PRAKAASHO 261,330,120 *1983183F97143170700EBF3DA24071C64DAF7E93 deathofthewhale 261,330,121 *19853758F619E979A20A1C12C746B9ED3F3CF0C3 6THCENKDA 261,330,122 *198EB38DA006A081E7BA4122BB00212A130AF5FB 6WILLIAMHERSHEY 261,330,123 *19872AD5EE2AAE9D47B11388E07CAE0ECC2F4163 760REECE 261,330,124 *1981368FD37879812674AB48D3B8BA4043C3D014 deifrearlausemann 261,330,125 *1989CBEB1F617D4048F9F04E624B5647C09297B1 DELMERBOTTARO 261,330,126 *198485A506AA230625DC7B6FA74B96695E3F1731 delus1onal 261,330,127 *19850A460A236039C704EDD0635E077E330A52C0 DENDRIETEN. 261,330,128 *1987F9F8961778950D50506531B946FFF19FA55E 7HENLEYYELNEH 261,330,129 *1982C553A541B72080C25FD82E079FDD527D1DC1 7IFANATIC 261,330,130 *1985918FB95C72A089DFDA8DB4B327FA42DA8D04 7IGRAUEN 261,330,131 *198F96A758A10B24724C479998C0DCD4CE6A94A1 7ilovecirque 261,330,132 *198936C60FB1F118A163A69C44D5F0197BA9571D ZIDANE TURLAO 261,330,133 *1987DBD2468D03552C70AC23C40AD775FBBFA1F5 7KATSOMUS 261,330,134 *19835F30BFBC2C6B8DEF29C917730A08E3388B02 8HTCHPRF 261,330,135 *1988803F1EE5155DC2949CC48A684543E81EA98C ZIPPETY7 261,330,136 *198B1403EB1EFDFE003F0D1EB4FCDFC3BBDAE499 DERAPEREZ 261,330,137 *198A5AF8A966EEFC14A5DBAB045BA1B4F7D410BF DERMITTAG(CONTRALTO)-RECITATIVE:EMPFANGEMICH,ERW 261,330,138 *19865D629F5137F4962ED286E0833E4D66E79CF0 7SPACYFIKOWANIE 261,330,139 *19812DF52316B739D5BD5AD9000F68A1B515B759 DESHARVES 261,330,140 *19865E1D720978B888049EBC398AB5FEC55C1CC1 ZXUYBB 261,330,141 *19859449B940D32643FE37A838C1B8ACA58ACCC9 7SYMBIOSAR 261,330,142 *1984A7106C6336E8E0F33F14B553429CAAE0F18F DESPEGMOS123 261,330,143 *19874D7075E0501C26732A9A137EA29493A82FF4 7TNAILIFF 261,330,144 *1984928F56EB21BBBFE03763DB78BE4D96156450 detaefe6 261,330,145 *1989FE217BA01034277A4F7810776CBC623AF7DA 818317 Ornek.:.topu.orta.yuvarlaGa.koydu.ve.oyuna.baSladI.. 261,330,146 *198613A1F2F4C2324C17C2C037BE48C8F25F60C0 82872 261,330,147 *1989EBB715638043C5C80602D25D256B6ABA1CD9 875383 SEMT SAHASI ( FUTBOL ) MERKEZ-DERESAKARYA -TOPRAK ZEM . 261,330,148 *198B3534D993B685D61712969C4DE9B8B0EEBDB0 8RASSOULL 261,330,149 *19876D6D3DDED8D04F6E16834A6C9F146A4149F1 8RICKTE 261,330,150 *1981975515B6AC73BEAF0D354DF19CEF014923E6 8ar0me7ers 261,330,151 *198432E87BCBBCEEE3D5BFDB44CE8FFFA517B3A0 8SNIJWONDES 261,330,152 *19821E3021B94D762E54BBF8F3DA0991B87F1388 D#GU6 261,330,153 *198BD96C3073E1547F618B9E5587F7306A75D697 8STAROBNICH 261,330,154 *198D02E8092321055FB588C64E22F2E71D75104A алдуррен 261,330,155 *19838347FF4FA93EA722D79F3E6BF6EFB8CAF43E 8THNKBSW 261,330,156 *198ECF2FD9B28713F05965559D0786E2C1C1EBA0 dhoem 261,330,157 *198B6A82C8622AD74F56DCF314B8714C59D0FACD 8#####D~0-~oSplat 261,330,158 *19883B549431F00F786F201C271150F003C1430F 8WALLEYETONY 261,330,159 *1987E39657235ED558679105D4905D4A10C76299 diamondphillip 261,330,160 *1987C2B688DD44BA6976ED55D3562A9C1196636E 939320 VS L 261,330,161 *198FFC03DCD490A4CAEE29DC1B1000145ED5E737 ГОРЛОВИКИ 261,330,162 *1989773AA228C4C2CDE686EEC03C9A80EFB19636 DIE.VIER.JAHRESZEITEN.(THE.FOUR.SEASONS) 261,330,163 *198BCBCEF0C9DA8263AA248FB3A6D2DCCDC34504 D?IGI 261,330,164 *198F0546AB423C6A8407E85F67EF693C174FE3F4 DINGLEY'S.BOOKSHOP 261,330,165 *198E9BB5CC7A994BD0F135137F47112D34D5C48D DinieR. 261,330,166 *198530A9B2D47460742560F0FB27D6EE7CC0769D DINOLINGARD 261,330,167 *19856D8D4C2D619518CF47B1092B3DA057BCB28C DINO.MALEK 261,330,168 *1980C63981894439FB251333877DD80FC552A68C 8HANEBHCA 261,330,169 *198E51B9B5FF65132CED02D7447E4E3B6F823B41 9BSWRCEIBSW 261,330,170 *19816E156F505446798585553EE0C7DC101F5C60 картавирье 261,330,171 *1984D5054FA6A9F96AD1A1DB17385BD517776B32 DIQ@HOTMAILCOM 261,330,172 *198FBF3E10EA285F38F36DEC349A047F250E2CA5 dirigentes-de-copei 261,330,173 *198631B67801D4E12ACF191860666ECF4D6D4D48 8MPSOBSW 261,330,174 *1988E62110FDD57FF539D12AF52C0BE014B835EE }8{ O~O~@-----3 261,330,175 *198B27CA85E30C6C5B264C3E5A17D9D0002A7035 djmhe 261,330,176 *1989CD9AFC134AA4B60979841EB25EE7AAA2ABD8 9IARINACC 261,330,177 *19894ED9C96C221257E4511204C66EDFDDA22668 9IMPLEMENTERSES 261,330,178 *198D7B82CC6D61FF9F78DFE36CB07D45295008EC пазоли 261,330,179 *1985B14EEB7787F8BA072AD1BB0AA359B52D9D4B ПАШУКО́ВО 261,330,180 *1988500DD95AC000A91E2B989967157FA21FEF64 “ПОСЛЕДНИЙ” 261,330,181 *1984D73F30BDEE17F9C8920AB272FCFC52B5C252 ПУХКОГО 261,330,182 *198DA55D2F3A68C8593661471058F2483E2C956B РИЗІН 261,330,183 *198E631716CB7DBB069AA57A88684395460E2CA6 DKYOE 261,330,184 *1989003C8D31E3926EFB0CC232C00B87BA6F66D9 dla9b 261,330,185 *1988240B2319DE6D24CCC3FFD2B9F59309DFECC0  НАЛБАНДОВ 261,330,186 *19809D183A3904CC4971D6D92B56CD01C12FA865 8TOBOTHBSW 261,330,187 *198BE9886633BBE9ECCC91E127C481FDD8FFA5BA 8TOMAKETHEEMAD 261,330,188 *1987EE83D04F6925C478A75FFC4601B53EFB38F1 9PARISPETE 261,330,189 *1985E6137629002AD0312500AD84F5A1B80B9B01 DLZa 261,330,190 *198485E3DFCEA4989C36CD776AD73C82DF2B0E06 8WILLOFHEAVENSTARTUP 261,330,191 *19866D193B79F2F3381077795849043447107747 905186 onokbudunemgekkOrti. 261,330,192 *198B79F78BFD5BC3936EB9B851285C6A4911B1E6 dmq:v 261,330,193 *19825970555E9D5FC0EA5C02922D7E5860D1EECA Dn4o 261,330,194 *198B556434BBB236B55DEC3D353A7345FB0A8EF3 978LAYLA 261,330,195 *1982BEF1EDF6FAABDA5BB36576C5B52FD28F5F94 9BIRTCHEL 261,330,196 *198227D3E433277DF94DA5089018C078C73A0A42 DONNE-LE-MIKE 261,330,197 *19837A315A4A6D11B83ED3BEEA457FB7F15CDC53 donsharons 261,330,198 *1982F70D05B665EFDFAEE3D1C9E159B64AF291CA 9DELEGOVN 261,330,199 *1988CDE58E0B7825E2932BCC3187958C783961F4 A_54R 261,330,200 *198E441C8D246BED80B2E4B24EB4688B927B96BA 9NIEMOWLAT 261,330,201 *198E85F5D954D56EBA0C84FEB3DBB1A9F2B18B78 9NNTMPRZNGS 261,330,202 *19892F6D0FB123E42D468863B33A600E9E3EE572 aaaq\i 261,330,203 *1981FFF10BD8E81E2DCE5BDD67F4A82D7EF792A5 DRBEAGLE 261,330,204 *198B7280AA749BDE184DBD6BE2078D11EE5DA493 aae\ts 261,330,205 *19875A1FD4ED72E0C4F62C97F72EC4834CBF8416 dsof+ 261,330,206 *1988313F373B90EAC9DE0358418E1D2AE3710F4F AatO 261,330,207 *198FD411AC35CC4FB4DC13005202573E8462B62D ab+v9 261,330,208 *1989B93A577082798799326B0219C643C24066A7 dut4 261,330,209 *19853B2243FD534A038D8B5A35AC77B34EEB938B DWNH 261,330,210 *19814527BAAADACFECFB7E50B811BA01DA9FA88D 065karla 261,330,211 *1988B5CCA1CEC767DBC9034D605D98A4448FB773 AACHAKAA7 261,330,212 *198011A51CDC1F11505B211C1017C165DA7E5711 admin@globetrans.com 261,330,213 *19872B986F1E65BE616AE691A79D9CDACE8FAB59 aadn>& 261,330,214 *1983AABCAC324EED440B92C710F772001917AA5B 1058987 (-IN-CONJUNCTION-WITH-MCC-)- 261,330,215 *198DCB87254C01A7C3FE936136264D8374CFD786 AAQCJ 261,330,216 *1988CA4CE5976319CC7FD2B8EC6ADF2B62111FCA a-e-i 261,330,217 *198BD933F183C411E0E4A773CE7279E13BC0B782 ABDUL.KOSMATKA 261,330,218 *1982EC425440EBEA16040121021E1A516CF1F3EA EDFFA 261,330,219 *1984B6656C7C018AAAF742BA6745A0260DD46A3E abigailwhateve5 261,330,220 *198BE1EFAFA2C61761D0CFD4FC4330C9CBA7DCB4 1482092 KOORDINAATISTO ON T 261,330,221 *19836A26029B2D7D5868F6AA5FA2835E8C370587 EDR2R 261,330,222 *198801ED75DC2020B6017E33427ED6B4437606F2 AHMADSTORM 261,330,223 *198ECADF5F6F8AD0686267785E71A7579BD44E22 ef$@ 261,330,224 *19828DB71F6FB5451E7FB5CB823AA10F4C980F42 A)IAH 261,330,225 *19837411DA43FF3130A3C9A6496EE3751059789E aciot 261,330,226 *198CAC2648E04A734471B02499F22DC1011DE170 EINGERIC8 261,330,227 *198A85093762E1E158281D2B49D7E1425684CEB9 elbertfrese 261,330,228 *19874F3BCA3E65DB278EE506E1538906CBF12B93 ELDON.SUMABAT 261,330,229 *198B09FA2FA9E6DD17999E1F4364ECAA6C00317F 1AGENDASI'NIN 261,330,230 *198299B65B5C7D4FD9ADF29C985FC7339AE92A74 electrograters 261,330,231 *198227AECAC6A142487BA8C8A6B93507153EE9F2 a-de-cudillero 261,330,232 *198DE8170CFE11AE8F9F7890183D9B44E75E2F6C ELIJAHKOLNIK 261,330,233 *19809A39B5DC1A5E0495A1AF4A33E010B430B849 eliseobluett 261,330,234 *198B440229CD3272F59485AA58158B67DB288DEE 1-avoimissakin 261,330,235 *1984E9733135AA3F60AF84162B9C3F2D0FD8B050 1BALETTIENSI-ILTA 261,330,236 *198155C4EE2B0C80E1B8F715106C734EFCFFFC79 AKUD& 261,330,237 *198EFCA6E2017FC2EBE1C6CE11A136D1D374C95F albertoclosas 261,330,238 *198C3CD829BE91FC0164387FF1363408569B7A2B elxv@cdccom 261,330,239 *1984759F6C2B8379C2A165A25A48A98FC8593163 ADTM 261,330,240 *19893FC0E1AB2650CFB6E3849138BE90698B4D98 1ETINMED 261,330,241 *198A48704A6FC03F915080D75864E24009AE96D3 AEIF 261,330,242 *1988A36FDB848057EB697F3F154813EB6AF6C3B6 EMIL.LAURO 261,330,243 *198F5C6788819B9CA11C319396D25B7270F6F479 AF2JL 261,330,244 *1982EF252542A4C3CC3D4D736BA2763C6DAFC401 1.ikimachon 261,330,245 *1980E1CF657CD485210E1D87BF2E322BAC2F0C6C 1ILOVECAT4 261,330,246 *198D0839A6616981CD7F7639BDFFF1CDDB069019 1-istsehr 261,330,247 *19880888B04F2849DD45F065B7066A5ACAC0F83E a%f/i 261,330,248 *1980777151402CFB390EE4397E28A718468CC90E EN6741264 261,330,249 *1988584A648F49E9A3CB5663AD95B43ABF87614D ALSTON.CHONG 261,330,250 *1988145F62774B8AC4128EC67B7E5DEB567FA063 agu4f 261,330,251 *198B66664E4C66B2BA001384A48DCE08026F2226 1olukol 261,330,252 *198CC80950B8BAD7908EA983AF255327B059188A 1.paikallispoliisia 261,330,253 *198E1927766DF806BF8917985359EBE007896D5D AMARGAI123 261,330,254 *198D39CBAE1E783B80AA32C663A98F0C585A528F A"&HP 261,330,255 *19846CDE07987C741F078E5C30620C727F1738EB <AHREF="design.html#HDR1.135">1.1BACKGROUND</A> 261,330,256 *1980871438A4B722737C6F7282481F8096518738 1PRICE-SAVER 261,330,257 *198CD9CB3962E0DB17B357FA0962CA08AFD84069 AI3Q4 261,330,258 *1981439BCEDD6FFB26397ABCBE5D23A2E4E0F7B8 AMPU+ 261,330,259 *19850E0441F5950A200E4C0CEAB829AFA675D909 ANAND JAISWAL 261,330,260 *1980BB00D5293075DF118E06C490278EA918FF11 AKHUNZADAS 261,330,261 *198ED9C66E890199CCD2A28D68A80050D674844A ANDREA.OKON 261,330,262 *19858B9B8F8219273518767E91F4B41D5180C232 ERKDW 261,330,263 *1983B2E42E353A7C05355C48C21053AF94FC96F2 alapaha5 261,330,264 *198971E177EC3CD244E4C9403790368A52D57F83 ALDO.MAKS 261,330,265 *1987F5D87118A73F3970F04530EC4CBD6D0C5B14 ALEC.BUNYAN 261,330,266 *198400C508E42ED124D30D8E84782F2ED3EE49B3 alecselzler 261,330,267 *198920AFF95B63D13819897450F3BE92996E62E7 ESMURRASTES1 261,330,268 *1987895CFBCB76DA34B123B3223B15817278D6FF ETERRONS 261,330,269 *198CB5FBC3774B5EFD41BD0CBF069D9F495E215E ETSIURBN8 261,330,270 *1984E28329AC81FCB6188B916A739981C65DA675 anhourbeforethelight 261,330,271 *198ACFDDC84B2667FD743E6E024AD3EC7349B60E anivelca1 261,330,272 *198F1E5CF69C40CAF4A3437D33BF6C8AB34B93A3 aliceholdsworth 261,330,273 *19810A86ACFEA24D7D23230CF0BFDDDB749A10FB EVERETTE.GOODFRIEND 261,330,274 *1985CEC37EBB7A0C0E146957E6C1585C8E3F0A46 EVERETTE VAUGHN 261,330,275 *19839840F9B1206C367E15468B811B178FB18E06 EVERYONEISEE 261,330,276 *19826AE2D8D87868A00CB6E98B015895FCEBD51E EXHUME-(A-LOVE-SONG) 261,330,277 *198C25B653D7FE2CAEB0A4E6F55CF8A6C76F8ED5 22061004 261,330,278 *198DE3E85588BA4E3ADBD35088CDF446F326AF32 AMAZINGGRACE(BENDITOAMOR) 261,330,279 *1987FACC37F5668E072436B43A76CAACF8DA9614 AMERICAN.BUSINESSMAN 261,330,280 *198CD1EE90BA3ED37E23C1B0AD5E680BA5A691F6 A;P;$ 261,330,281 *198C0CEA0CB1EB2C39D397DAE7E1B01201B47A4C 233HASSAN 261,330,282 *19837D38A65681604A55C97F56DEE5F6F0DA28C3 246218 DIE.DREI.VERLETZTEN.SIND.MITARBEITER.VON.ADEGUI.. 261,330,283 *1988990C3EAFF8B0DAF4254AE06766DBF5F71EF7 24NOVEMBER1350 261,330,284 *198BA3F73AC200D761BCFAC22E56A80A205B670E ANDLOCK6 261,330,285 *198173DA6AD4DAE6FB96A91610CD557F284F3D07 FATGUM@HOTMAILCOM 261,330,286 *198069B46939FE1EE766384CCEB643B0972C6EAE Aq:4 261,330,287 *198BC62D4B1142F71F0E280B6DFCCC8D7D9DE02F FEDWIRE 261,330,288 *198A205D889CEE2CD62AEAB74A77F4185A451BFA are.you.still.there,.cherie? 261,330,289 *19831AA323BFCE9EF893F6D7CB9F611822573077 andrepalladino 261,330,290 *1988A10E312C6EF33122480E5C59DBDA807335AE 261164 ERINOMAISET EDELLYTYKSET TOIMINNALLEMME LUO MY 261,330,291 *198C73343F9B87F3EAE47B08B0F27290ADC4F03C arnulfocolasacco 261,330,292 *198DFF47C897DE16ECA94F760074B43A64944B35 2622263 jamin 261,330,293 *198FB5A2583E28E483A27936235FF4632333EA50 ARNULFOVANPROOSDY 261,330,294 *19868D5E2EB390424306E728EB5BA4F24313E97B arriejesé 261,330,295 *1984F228079933D7434D7F042A967283909F773A ART-ALTNURME 261,330,296 *1981988CD6BD5A19757B40EF463F35412F542A80 fidelgerster 261,330,297 *198263E6CA49F94B1C7A4E08A4A0CEE7461705ED AN+H3R03S 261,330,298 *198D3CCF99BB6FEF9A08F8A642461C71468393BA ANNAMICHELL 261,330,299 *198E23D13670D98C2B681FE404B8A23AC146ED86 ANTHEM.FOR.A.FALLEN.STAR.(RADIO.EDIT) 261,330,300 *198DACE2203DE61C21B13BF0D23B80D9BC32B189 2ARTHURMAC 261,330,301 *1982355B7D888682F943333029ED7A0CF7129DBD ANTIONE.VONSEGGERN 261,330,302 *198363F452CA921EEABE0505F0DB949EBDF051C2 at%_" 261,330,303 *19866D2E7F130FD2BD363C5FDEF41E6F426845A5 ATAEB 261,330,304 *1985DBD478F341806E0D26682E72444B640C40B9 foobarl 261,330,305 *1983C7BF14811F3F94DC3CBC655090212A2E9105 aorhm 261,330,306 *1987671C241807903A2ADDAB70A7DDEDEE965352 2 LIONSTOIMINTAAN 261,330,307 *198F43E054D0F4B87B9153E87A6270E205AAA244 )2M 261,330,308 *198CEE1C0212668630232385D3D05B358DA1990B franciscocapaldo 261,330,309 *198824897D8F09D9B907FD9580783A683CFAB8C9 AUCTION.ROOM 261,330,310 *19842545483DC8261BD71BF17CD03D2274F62969 franklynvassen 261,330,311 *1989103090BB58F15419E6659C07FB3459755F33 AUGUST.KINDREGAN 261,330,312 *1985C0E1E3853D5A9FFD44105D963EE34F273351 augustvardy 261,330,313 *198CBBA0FBF2592F7997C3374509DE57B6469D55 a"-q 261,330,314 *198988A3E0AF2E99913350EBB79CE94C75A9F9D4 FREDERIC.MCPECK 261,330,315 *198486A5828F988B92696F71741CF07C7893B272 auk7h 261,330,316 *1988338D5D609D9535C882C571BD32663CBE5508 A+V3K 261,330,317 *198001B7CA5387AAF8A17CB38012F8E59A10D64A ARBITRARYNO 261,330,318 *1982AFA384E77639CA1B567DD25AF5CE1E84D805 3B<-~.~.~.@-Q 261,330,319 *198F8E23D81B2D79ED78FEB2710B0EFB0B8D0E35 a+wg; 261,330,320 *1985EA6BFCC5E5FA4BD6BD5C8D95D2CC2008372C 3#####d~~~(0-0) 261,330,321 *198836887C938CA2CFBE2385BC16117FAFDB8CF8 AWWL+ 261,330,322 *198ABE6116718A84132F6299CA7EB4AC71E1179C 3GRAVIS9 261,330,323 *19809EA282C67863DCA33445E6A4C1DAADABFC95 AYXNMKIBJ 261,330,324 *198C41B872E09969EF2D088C6593A2EBAF7CDEB7 gallaghers.steak.house 261,330,325 *198D71ACE09DBCDF4DDF368EC996987EE0451679 GARFIELDORORKE 261,330,326 *1984435C24EC8EE6316E7F2DBB9773FC17213D1E GARRETRIDELL 261,330,327 *198A4E7B9FE5BA496EB30560397F1C69B84AFD45 Gasshell 261,330,328 *1984F52437262530B127AD7BF4488658BECF44FC +3mp0ral 261,330,329 *1987804A3CD2D0AA41FD0E8A667CECFC001C2948 gaylordruggs 261,330,330 *1983729231841DBC452D258F9A7B6DAB6F81BB38 (>_<)~`(b 261,330,331 *19801D64BF7004F0D487CE906B60EB89F455FBDD a,#sf 261,330,332 *198B770CFE2BE4C845F200D2EDCAE694516A076B GECODIFI2 261,330,333 *19809FC1AAF9F2E0DB09EBF5EEE3F849A1B7C163 ashp91 261,330,334 *1983F8DC138C33C66A928600C0473700550C239F $+-%b15-$+-all 261,330,335 *198C6915CA5D49D3E1276671BF8D7D7D65F451D6 403v 261,330,336 *19810561742851A328F9E09CDC1C981E3F20AD9C assemble@5415com 261,330,337 *1985A10AD264AC0FA40C28E24EFDC43A5A09913D 448arely 261,330,338 *198D112178EE75189B5F3D96A0F42D2F798A40FF B29R 261,330,339 *1988A8401F9A94F79A5D2D4441D747A95A02C32D AS+$X 261,330,340 *19843E793151E04CC59F32294410501A7F69DE5A AUBHAV 261,330,341 *19893C0EFFB9B5EF65300B2CC4CBA418B803BC31 gfs.samara 261,330,342 *198ED61B6D0BB991E4A81FA99749BB25071ABD2D ghedans6 261,330,343 *198C6D1AECD9C9B15E6EAE79B4BEBE588F429B08 4-FA'AGATA 261,330,344 *1989A49D5BC8257178E2922CB52230D5E17AAF57 AUPETITJOUR 261,330,345 *198DB7DE547006964A1977E5F9D39238A1712952 gilgunderson 261,330,346 *1985823A900506E473865C96475032C29790A49B 4KAEUFERK 261,330,347 *198F9462A9FA02012DFDB4A1459EABD1A1601C02 B9GCU 261,330,348 *198768B19165A1062933713A538408ACEE78DEAC AV"48 261,330,349 *198E65B16DFD7167B5BF19C6941668042D593333 AVIDOSH 261,330,350 *19894F4F3A5370469DD0A5B0EE9B8FCCE7F26A67 4N4CHRONI$+IC41 261,330,351 *198B83CD920702F675BA6EFDA672A7B9B05E0226 avix# 261,330,352 *1980F5BD0DF73EFBAEE91D035AD15E40329E1963 4TRANSMAKING 261,330,353 *1987DC8F261F3542F742FCC6938D3106B3B41128 glennbrowe 261,330,354 *198634E2647C05DE09A4D28F9688D69C7090A606 awwe, 261,330,355 *1986B333DF820987454A76582FA20F9D0ED63D70 AXZYP 261,330,356 *19800FD47182F3B7309A1A54B2E2EE3E89A358E7 504isai 261,330,357 *198AB9856B103C72FE00E40D99EEACB96E6824FD GO@E-GOGR 261,330,358 *198CB553F9D0DEE90F123ABEE236AD327A3286DF az"ah 261,330,359 *198203FAEB96B991B2E90677FBF4C1E8BA43FE3B B;1?W 261,330,360 *19836E2FB9602CF387355FEF8B8EA75DA55FD7E6 5cchtp16 261,330,361 *198101819096884FB11B5227776CE74F5D10641E 5DESETINA 261,330,362 *19869E8DF14D1195CA72C12926D91A95C86037F6 5DNAREPUS 261,330,363 *198F570BE5F6DD8085B426FB4629310116D0BA16 B4CNA 261,330,364 *1989C78430CE0210D888341E4DB8416FBF81FCA4 b4n!8 261,330,365 *198DE040E458823721E7380F50312F576661A3C4 gregdavolt 261,330,366 *198E56D3B6177D5F3E643ADE9DA7AF1F57677056 BD9CL 261,330,367 *19829C6BC75D3C1156A0E1A665A44CD05EB87CA6 BDEAN70020@AOLCOM 261,330,368 *1987D84C29931805A176F2434B70BBC2685340AB 5HUNPHSOKMDFMQM 261,330,369 *1987381F02470DDBAE73CDCA114AB05470A92201 bd?ki 261,330,370 *198E45877946A76A6BFC006DA77F3DCA0B7E578B grppllz3 261,330,371 *1983CD1AA6E31EAA3A126A7E2CA88C5789FF533C GTCOLLECTIVE 261,330,372 *1984EDFD5C55F13ABB9B202656FF6CD856B2F694 'BEAVER' 261,330,373 *1985447E00000A1DBA4EB3B7E26427ACBA260439 guaisca 261,330,374 *198C0A696123E6046317B851B96236BBAB4A3DEB 5NEWDESKS 261,330,375 *198BFFF9E90101C815981764BF237743ED4D2A55 guastammo! 261,330,376 *19873620CA8995109E827A6FFE2F64D1A2CC9280 5OV1UPAOXFYC 261,330,377 *1988B533AE6FB52A258B84FB201A45BA5D90CF48 GUINÚ 261,330,378 *198321E8F7CA253172568EA240D63D1CE5C75893 gulfcoast.getaway.2008.freedom..worship.2 261,330,379 *19862E9180D6F6DE8D056B5687C884368800989E BABBOTTABAD.COM.PKB 261,330,380 *1983805F9FD51025E954B92BC7A1F6C42ECC8A9A GURINIRE 261,330,381 *19867230209B39CC57B715E1A02B56570A276DAC be:mh 261,330,382 *1981285BE79107551B8F7FCBD8F7C7770B4DF739 benedictmarcone 261,330,383 *19848F46F783D7D8E95A78653CAA9A03E5522FB5 badlilgirl4eva 261,330,384 *198E35EB51C5093D71C4ED9CDF00AA41DDB6A542 GZBQ@YEAH.NET 261,330,385 *198428252AE5C49C26CA9BC13F5393E2BC126811 bentlets5 261,330,386 *198A6D6D22754BD07C105885DD19073A2A566C86 BEOH= 261,330,387 *198B7B59A7B23913CF640054C5FA2B524B269329 5.tuotesuunnittelija 261,330,388 *1982F762B7DBC14B7D79FE230D5E7195FEA1A12D BERT.ESHENBRENNER 261,330,389 *19854C5DF95D9D0C85CBFD0279FDF6FD060C7C64 5YSXHXAU 261,330,390 *198B74F357E7BE598FE469032A0DB514AF1167D3 bethankfulforeverything,forsoontherewillbenothing 261,330,391 *198C9BCA9C6565C522D9C5CEC114B1B6CB809F4F 5ZENTEIBA 261,330,392 *1986143BA90E1B880A20FC37823B0E3D2949E1C3 BANDZAHLEN 261,330,393 *1985E18B7A6EE6B453C63B9E0E48C7816DC2A100 b|ao 261,330,394 *1984B259C2B0A0E0F6970FD9962A66A19BE345C6 BARNEY.RETTKE 261,330,395 *198AB5F989CF713BCFF4C99A685CB01F9FBB9618 harl0tr1es 261,330,396 *198AA849ED1C031B06BBB37D6181A789052AEBF6 HARLEY.VANRULER 261,330,397 *1989BCE70BD41FA89E9B67A6695189CF78369CEE b#ft_ 261,330,398 *198ABE409D4A28815CA6F756B15091785A53740D 6BRIUOLI 261,330,399 *1986C1ED0747F3263A746F1B08E67DE1C0091072 6BSWFORSTWIRTSCHAFT 261,330,400 *198E226FB084EBFF300A200ADE3905A4BE73D7D2 BAY/ 261,330,401 *198FCE79464EE79A13EE4774BF53C91E7D632285 henrydancy 261,330,402 *1985380B5037742D576109ED918EC7BC0EAF9ACC HERMANYEISER 261,330,403 *198E3F85A65B9ECA41F19A7514164C4B99314240 bianca-gabriel 261,330,404 *19845AE6E24140A4116A5658CB4B0A06ECB68906 BIBZ@INFINET.COM 261,330,405 *1983BACB332A181E3B2F966706DE32EE3486228F b&#co 261,330,406 *1987562B856EEC9CA91A8010E755C9D96C098F64 HIDROSES 261,330,407 *1988AA3368C811128A02500CE04A8BA2D473AC5D 6LITHOTONE 261,330,408 *198A377997CD6BAD91A77E391AC65AAAE54A922C hiltonloche 261,330,409 *1987D2E0D85E6559AA48F453169D3336FB8A2611 birvy 261,330,410 *198FB3DC0AE42FE0A763222E205E4EF30BE1CF9B HK(AAA 261,330,411 *198C75D4F5B1549D2F36CB34AE7447D40796D257 becker-&-fagen 261,330,412 *1984B8F04F0EE8A8AA29446608A92CC683212EB1 BEDĘ 261,330,413 *1985EBF1EADBF4A58ED56AC6E265CABB642083E9 BEE1+ 261,330,414 *198DC88F9E5BA92D41816282CC1C7BA2A6233FF8 hoai.linh 261,330,415 *198FD6BD551AA339A8EB722FF67047F368429F33 hodoxian9 261,330,416 *1984FEB8A26C6886DE6B620D63BADC65D6FEDEBB 6PACCHIONIANS 261,330,417 *19806976D2B80F708F04D8D593DB8A36E81ECE45 holly!! 261,330,418 *1980DDD71791BDAECBA4DEF65E07E21B326ED0A8 hongarije3 261,330,419 *198AB057B727EB695A9B36135B5FED222CC42F11 bernardogarc 261,330,420 *198592AE7594569F4A0FFDC8632697388D313B1D BLAKE.CAROLINE 261,330,421 *1980FEA12F03F5F44193FED2BE19806E26B99A82 BERNIEBISCAHALL 261,330,422 *198F80C97FC8C45D73C0926191CB856E0C8A2430 blatzmann 261,330,423 *1985A4A179A12351F4900B72998F4C42463C701C hourmaster 261,330,424 *1986CB670701A55155CE63972475EEA06DC12FF8 bez4leel 261,330,425 *198BE99988F3611FA392B91F3DB13632664A9D9F HOYT.TREGO 261,330,426 *19877C6548EE3AA261CE8C80D68CF15051C46BCA BF55C 261,330,427 *19881B6C56DA8C4570A1EA707310E9A81EA0A76E 765IVAN 261,330,428 *1982ED66C054374AF22C6DA39AFAA1D1041233A5 779193 T 261,330,429 *198FD25042399058BAF88266666E5B576533BD30 bm$z( 261,330,430 *198DCE6F70FA6BDA63D12598B4BFF3F1B03E3A89 hughdulberg 261,330,431 *1982CCE9401D544DF5F1512DB1169EE1EF714F01 7BSWSKUPSTINIBSW 261,330,432 *198327C90FA554FF0FFE210F77DC9B6721010957 BGpT 261,330,433 *198A51DC1C96D12E481F5D6F358870AEB795C85B bhk-( 261,330,434 *198F74470E86704F6B66091B4DCCFCA81B518922 BO3 261,330,435 *198BE28C7FD3FA6CBF5AA06ECF11BCFD1FEB7F0B 7HOMOEPATEN 261,330,436 *198D5CA4B362CB41DB7C2BFA16607DD448DB3CA0 bikc3 261,330,437 *1982E87F702DCEA09459E60B3527E7CC8CB7F8AF bolnima 261,330,438 *19811BB7C06BFFF56C8FB1CE696DCA266F571B85 ICAN'TFINDMYSHOES 261,330,439 *198F7E34B21BB5C9DF2BFCC5EBDB510B010E3F8D BILL.SWICEGOOD 261,330,440 *1983035DA3F746D2B7D61645379AF1F1CD157F4E BILLTRABOSH 261,330,441 *198C8EA212C7B3F95793A45DDA51E7A9D4813E13 7OPEGRAPHA 261,330,442 *198C7070253F241D88FAD8C0E74CCE14BFDB1673 biokemije1 261,330,443 *19824FAC357617A2B6E9A3E1BE1C094D5DAA29C7 biol& 261,330,444 *1985529561B30ACD271CF45A53C5867B43112936 BOYDRADOVICH 261,330,445 *1982216F039E855F71D9F81CD06D9F052760E860 B---P `~ `~(>_0) 261,330,446 *1987A298D2F15008B3D5BD74C9489143B286BAC2 blao 261,330,447 *19861E293FF5512089AFF38B181D6372D357A554 iluvnormal57 261,330,448 *1986923C588E7B0C768B816060902B3DAAFF837D IMAGEOH-252.SVG 261,330,449 *198AD1D05983E0E98E68833D87A4901AB01FAB99 8BOOBABSW 261,330,450 *19875C6A11523EDF141CDA4B713CB95960B6E7F6 BN6D% 261,330,451 *198A5B5BB62ADE2159C2A7511849F5F9D86A1018 Break-the-Silence-(short) 261,330,452 *198D2534A9B1C3D0D27DEC7F7AA423FA91C44730 BNY9 261,330,453 *198CFB2F299CD6B26E2E49988E3C6B4FD6D8904D 8CUDDLESBRONCOS 261,330,454 *1987114091496DA54AE36DE614A9C36ADA432DAF BO3 261,330,455 *19853CC41BC2C756006CB163F357A7C572FF9891 ingaggia 261,330,456 *198A21E5CE7A7A73A80327E7C55C8B557229DD4B bronzenadeln 261,330,457 *1989DA573CDE5E6FBA20A3B7E94ACB8F5B4D9997 BRUZVIDZO 261,330,458 *198504ED77EFC9384E25EAF67350B385198CDB24 bryanshekey 261,330,459 *1983A518D932640ACDD2AF6A0CC20608B37FEE09 born.to.dance.(dj.dean.mix) 261,330,460 *1985253C6672A435F026E3A0FCAD1CDB38A6452B B#SDG 261,330,461 *19831ABD811C74764B85A338480810AA0E6E8960 B==P-`~(>-<) 261,330,462 *1985126CEB61D5F2F02A53A9DA7C84E7E8B96610 BSPPT@HOTMAIL.COM 261,330,463 *19836B309EED856A4C770BA407757DCE0E98FDA7 irvingkappen 261,330,464 *198BFF043AF6F7FEBCD4D9FE7F840297711FBE77 8REKAMTAEH 261,330,465 *198250C5BB770984D19E4A13EC9C0947A9CC812E B======p~~>B0 261,330,466 *1985B8400CF3F491ACC36759E3F2318754E17366 BSWPUCHADES 261,330,467 *1988D1B2FBBF66D8E96DB5F1BC82A6FC9C061311 bswreadxyzdata 261,330,468 *19884037BFCDC431A787291EB9FEF91E3237C735 8SIJOITUSSALKKUJEN 261,330,469 *198B70196A2F359B55A429F75B56A2D234A45629 b)p/x 261,330,470 *19840C12D8AAC278BB0B5F25883A603E8720EDFC BR5/L 261,330,471 *1980FCA8726620427E7AE1B0AFD919F81DAB1F04 bradley.paech 261,330,472 *198ACB49CCA987E399A0C3E50E90D9A224E928F6 BRADYGRIGNON 261,330,473 *198EA5C542380443A282071C108AF4003C3F921D BTTD) 261,330,474 *1984FF09DC23BBB31D5B3A81DA83CAA6A9D05F28 985935 Cavusoglu-mh-.-spor-cd-.-no-:-38-kartal-/-ist-. 261,330,475 *198FB7153E5E08B93B4B9560717844D54C3AC0D9 BRANDON KOSINSKI 261,330,476 *19868FC987C74BAD4F9D54BAB7B5A1D2ABB8B250 BRANDYRUSSELLELLZEY 261,330,477 *1982B37498E5A940E19D53D7557AAD631491BC79 BUDLIKES9 261,330,478 *1982A0E1544FDE77C73AA3960BE3EA3CB16421CD 9BSWMEHRERER 261,330,479 *1985960F6A851D4FBA26E35A800C0598C1A842AF 9CULYBTPIRCS 261,330,480 *198768B190F02D9679262350E19C077570D596C5 9ETAROCEDREVO 261,330,481 *198394F278D7DF95CB197A0D7AD31E812F1148BC BRKFLWR6 261,330,482 *198B2185A4D5B0E97833910145AF306E3067AA8B 9FLINKWEG 261,330,483 *198DC0ECAF4E8A0108E57C1A500538F43518B0C7 9GARYSWIMMING 261,330,484 *198D4B52D85BAAD50A99901C39E47A9959FCD4A0 brr/a 261,330,485 *198A1E5EB51F313BD307965FFB16FB98A041820F JANELLEYU 261,330,486 *198C36706FECAADBCCF62E16DEF5CCBFE289CEA1 bwac8 261,330,487 *19807BD280D331F091D67C31DAC83EF474F7CD55 bw?w" 261,330,488 *198E21BA9DC20D8FDE2686990E57478E0F8B75BA javierborella 261,330,489 *198F244207E39EBFF012022BD54E69D8379D8849 JAYCLECKLER 261,330,490 *1982985ACA5F484EC1B3E3986C469809E51B3BE0 JAYLEN478 261,330,491 *1984B0996034CF8255A669FC8FFB6CC8E430F1C5 JEAN-D'ESTR 261,330,492 *19882B0EB72FCFEEB2C0BCA77C9738F6E79B63FF 9september1194 261,330,493 *198FC981516F1DC31892BEBA3CE2A7EA7BC06478 C0N$T3RN4T0N 261,330,494 *1983E2BA8E283D369C7B14D0011D60714809CBC1 c1"tw 261,330,495 *19835D1FCC69DE11F969F053800B72EAEDB6E11A JERE.KANATZAR 261,330,496 *1989B2E51E0CF379CD0F76C7FB7FFBF4B26E68A1 jeremanzanarez 261,330,497 *198AA6464744C0BBFE32E2CDB562C42B80E49C44 c2h3v 261,330,498 *1983B1A883EB6A99A48B4EC2DEC66B21B800EF09 a0fw, 261,330,499 *198F210020230CBB6A60545CC06A06A8DAFC9F6F b===)~uu 261,330,500 *198ACD1ACBF000C05BBE108B8E69608F21916D7E a0xq& 261,330,501 *1986FF665E9997C4144A7BFE9BC9AAAA37454ECD a"11 261,330,502 *1980A1B42B91394B23FFB7DD885209D92A8951D9 A2QGB 261,330,503 *19836D54225E09CC95EE970D70B046ABBD2CAF97 bvwwm 261,330,504 *198638690C8E847E15F6FB40419B423A86B9D7FE JOEYDELILLI 261,330,505 *198DB5B15216F17E39FA5185CAEDC6976B2E55ED joeyhormuth 261,330,506 *198A6B1056CFC66BD5677DE408F9D3BC4A2F8CF2 joeyval12 261,330,507 *19826837A38995573EA9F546ADB413068B47418D A7TL= 261,330,508 *198D95EF797630A88E6F3D4022549749C5F710F0 A-%:A 261,330,509 *198F33C04FB11382A46DE17D336FA7008885B4B8 C1O$ING.E 261,330,510 *198CC86A80A0B021D883782C79E54E29E3EC793B CANTERBURYKO 261,330,511 *1984EE4B32F4497E5A34C288D520FE170AEC56B5 JOSUEYAUGER 261,330,512 *198FEC223551DB5EA648AF893B634DCCECF53072 CAOPHILIPF@MAILCHINACOM 261,330,513 *198653F67645038268BBC3D9CD0C08F991F2DEB9 JOUKOURO6 261,330,514 *198543D733554398099C1997EEFB6E6DE9893CBC aaafp| 261,330,515 *198907B3E2191BFE137C87F7A7CB08EB6D8EC00D aab#' 261,330,516 *1984DFC04802B1672754B5181FF9791D77D78729 JUNKY'S LIFE 261,330,517 *198FD921D92C3537F025652BC8DEE3AE8DECE107 K7885@MS46.HINET.NET 261,330,518 *198EBB40342CB26A740A9EE39E220A5EC9AE354A KAAMRAN@SUN16.VLSI.UWATERLOO.CA 261,330,519 *1986FB66C5EA0569AD92E5D5A770565BA7109230 KADAREOVA 261,330,520 *1988B33B700E0200BB4C687C8DADA2B40B70B692 KANGARNOLDP@ETANG.COM 261,330,521 *1981F6C7E5EA67D2BB2D704484BE8163728CC10A karen.tegtmeyer 261,330,522 *19801AE7560BA1EB861914917B702D392FF4BB9A c8chf 261,330,523 *198F1CE67DCADC8495BEEC974581CE69314AC4A7 KC1802489 261,330,524 *198BEED77B8D996C3B6234936780BDA1C2AB281B CARRELESS 261,330,525 *198FD73E3CB042528E9EF508F8B7EF48F12A8210 CAISHUSHENG@GUAY.COM 261,330,526 *198C585519E0ADC669727D29100857B9D9AABC55 AAGAAAATCAAAAGGCAAACTACAAACTGGAAGAAAATATGCACAATGCACAGATCTAAT 261,330,527 *1985ABA7EA7E80AB25FACD97203683F53FB7200C CALEBSHATRAU 261,330,528 *198BD76CF8EDC155E452C2499193FF9BA2FC2B48 keiser22 261,330,529 *198E7F5999647ABF60E005F7983D28065AEF226E kenny-seegolam 261,330,530 *198B6193A604371F1C4F4E48CFA3FBA71C5CAFC3 cassey.scott 261,330,531 *198DE33C17D507ED119A73F353D9686AE4C57972 KERDANE1 261,330,532 *19806E5E570C7FFDB6B7774E636C6B716A0A08CE catapulterons 261,330,533 *19861D6C022F0C22E6452A0A23D61AC04FD47999 KHIẾM.NHÃ 261,330,534 *1989C04F839256A1A76E5AD0283672A815378A46 CB/S/ 261,330,535 *19891FECA1E5737BC67B7728BC5817AAEF548A8A cameronpierceall 261,330,536 *198763ECC8A91A4FAE786A24EAF645448F51B10A c-,dg 261,330,537 *19869C46081A75B2EB8176F1F4FA37510DB6ABC3 abrammassingill 261,330,538 *198A5352CF14AC02FB3B13A6ED3FF1F0CE433F09 CARIEN@CTIMAIL3COM 261,330,539 *1982977CDD85C23F904883365E3E828BF530B7B3 carillonned2 261,330,540 *1983C2DA0176DE71D40A5F559C362A56DC683993 KNU] 261,330,541 *1988127BCA4A055BF8D08DD969451EB5BF7DC451 carrollenochs 261,330,542 *198FA195CF3F49B5903A7FDBA37CE0A67238B8AF kolmjh23 261,330,543 *1981D2FA5319F5742060847A8D801702FC723128 ACLASSICYEAR(E) 261,330,544 *198D15C8CAA165CB0DA1D04DB1977E0C33C0A92A CF8DU 261,330,545 *19836A92DEE56685EA451E440E61CB61EE5785D8 CG_b 261,330,546 *198F2D8D1E2810D6585BEE7435418FB9BE220A66 KWAMBACH 261,330,547 *198472EE739B5DB016133EC9060B18B5CFBD4812 ADKN 261,330,548 *198D3D58C7613A02525BF9DF814C66E529E8262D ADMITIDLEY 261,330,549 *198C0EAA86EF5F3EB5A2062A5859A5AA9F179BB5 ADOLFO.SKILTON 261,330,550 *1984002F580DBCD59EDB3D6CFD49FD4EF57F810D cccnn 261,330,551 *198EA0B5866C264654572B40B3662CD46D3D25C7 CC$MV 261,330,552 *1980297C2A492448FC3F3436CACB915E37BF4C17 La-clemenza-di-Tito,-K.-621:-Atto-I,-Scena-II.-"Del-pi 261,330,553 *19866E9E5B23C377745CB729BF733E31EBD826D9 a/ed% 261,330,554 *198CCA61D3BC25AE96314872CCF456B4094B7458 ladungsfluß 261,330,555 *198BBF1423E173C79BC79F850E996D7C2267AB7C LAGERLOF6 261,330,556 *198049E48A83EF2BCF9CC2EB8D8C3391517C88EC CHCKNMSTR 261,330,557 *1983D489FCC9FC57ECC43D9582CCB09489C2C292 AFA2FF 261,330,558 *1985D2272B7D92FA9427ED695A5E7FB8CB2C72FB LANE.TENERY 261,330,559 *198A9C68CD0D29333A87B65531327814DDB94670 LANKORONY 261,330,560 *198D4094F19665C3F0EA634263F7962603D09938 larryklinker 261,330,561 *198CDE7CAB0DE7A29A6556A54265FBC45D957695 CHIACCHED 261,330,562 *1984AD42510F42C589E02A4579ADA288D0A01273 CHICANES 261,330,563 *1982CAEEB907D7F71997E9EF637A1D1F9418B780 a"fs 261,330,564 *19837FA1BF3C2455E7B55566B51A3BEB6818020E lcs) 261,330,565 *1988FBD3593B29E2ABC659958EA9DAA50151266A agt)_ 261,330,566 *198187534D6A67A505815629CCC854FB96CCB449 CHAIRURRODHI 261,330,567 *1982C4C6BE5BCC84CC7D3EB2828D4806180DE43E ahamadia 261,330,568 *198FF23E1974A81493EF0DBFB998BC33BA641E0E CHURSPEK 261,330,569 *19857BB21C805C98AA8D16B4220216F0F9DFB9F2 leavitta4 261,330,570 *1985B2E78B599D8A56DD0F0A913F8C044246FC0F AHMEDMOKRY 261,330,571 *19831C90FB5C2BB96212A8316565C5BA8D49A178 LEGOSYSTEEM 261,330,572 *19837E76F17606DB217A65CE2766416E47D56F01 CHEFREDAKTOR 261,330,573 *198091DDE1497B2EA0901B5F4DBFAB99B8E312C3 LEO.GRON 261,330,574 *198B1EF9790C596193840F6618A173EB2A3D8045 AJUTTUJ3 261,330,575 *198311B7D9580AF2C9825E38C49B1A951D939301 CHICANES 261,330,576 *1981FAC203AE77BB654B45E4E597931EC5DBB655 leosmythe 261,330,577 *198716A76B833E05D6534E93E5F49BFAB1FC2C50 CLAUDSCHILD 261,330,578 *198E62B4676C4E6266ABFF889A1FE9D97ED51AC3 AKPXJ 261,330,579 *1985A084A79CB93D9D8C3F0DB147328549F9969F aksentij6 261,330,580 *1987C13B286782AD03D54742018083893F630A30 cliffcarmen 261,330,581 *198F6999B59A9489F52DFCA1B24DCA1340E793EF c;me" 261,330,582 *198E07E9094746BE2104D998FFAF9A599FD0B204 cml"k 261,330,583 *19841BD63338A0ED4F0B4304FABBDE9B8ABD30A8 L.#G 261,330,584 *19800A20EFFD559EA92C2B453F353D0E3E462D38 CHRZCIE3 261,330,585 *198BB5B4412FCD6F72ECC8A8E27E6771162B5642 LIDYAR 261,330,586 *198038C710B734C61418FD7A7B67061EE86A23F9 ALDEN.COMPEAN 261,330,587 *198DF37AA800B79ED9E0FBF896E12ACBBA2EA193 cnorw 261,330,588 *198793868BCF642B43A6577FEF335894AAAC62F2 ALECWILLIG 261,330,589 *198907BA1D9186E80723613C94C3EAAC2FB2CC10 c,i:" 261,330,590 *1985DA6CA19EB985C4A5827CF04C009DC216E7ED COA57L1NE5 261,330,591 *19842D392C36255790A489C1B9060F1F2087ADA8 codytami 261,330,592 *19891F5ED87D3B88FA78CEA49FBD0B8DCB053FC3 c?o(f 261,330,593 *198C4A75D483864DBAB1E5B9C29C5BB117CB1566 coloradofrogs 261,330,594 *198D4A0346E7E73753E9CC35730659BD7097C9BC CIUCCOLO 261,330,595 *1983C66721988C0185CBBDE52055BA1F892F392B COMICSTALKPHOTON 261,330,596 *19859456F7FADE11D321E046E9F6E9D6130C478A computeraided@yahoocomhk 261,330,597 *19859DC96D575CA8F8F490A225E98FB07D1649D4 Lillian@36com 261,330,598 *198D533CA0E5C9E4A6C2EB6959C0CD3DC554AE80 cjqo- 261,330,599 *19871EEDEBE76AECA650C2236E11A319FBB77502 ck9au 261,330,600 *198F65F0FF11084DBDB3829C76EB8EF03CB6B56F CKON7 261,330,601 *1984D260A559DF5988E36484CE1C32DE49208C22 ALLYNNE8 261,330,602 *198B7CAA4F37CBC6A0194EB49E208FEFB6A2E14D LISSOMLY 261,330,603 *19831B693724E2FD98C389CC50815664F3DAB426 liujue@kalicomcn 261,330,604 *198DF78B9A80A09D50CE8082D340C30C1F3EEB35 LIUQH@163BJ.COM 261,330,605 *198986665649977DCDDE71CE364D2B14508998D6 LIUROSEV@ETANGCOM 261,330,606 *198E7C6B479B8A2B62E429602572EB25762B9FF0 COOLKIDZ54 261,330,607 *198AE38F8EE05A9CA483A8967F9EE0446741D1E2 CLEVELANDSOWA 261,330,608 *198AECA77C578957B5A48976F92D9D69CDA009EC am#6 261,330,609 *1983C5E0417000E041022F12C6D03D18FCA1D818 climatechangecoalitonsenate 261,330,610 *19848D36F6B629A8C0503D20A350522C3FE91DAF amersfoordt 261,330,611 *1987B9A58221D493EA6242A928D5CC1E5058C8AE LOONEYSCOOTER 261,330,612 *198B56CCDF049D2EE136FE4F0C47156BDA761D81 CLUB.FREAKS 261,330,613 *1988A1BD9FDF864BF47682FB933D57060D1D73B9 am"un 261,330,614 *1985CAA861DA3872D45177AB2D1A06CE559C9FE2 LOUKRESSIN 261,330,615 *1988D783E90325DEB55419D129C7CA83E3BDB6E1 c;n0t 261,330,616 *198E77C3543C142AC62E01F6D775123D0C4DC8D7 LQFA@BDUSER.HE.CNINFO.NET 261,330,617 *1986C7F80FACF3D22044DF71ABEDA66E8E4A3358 ANGELAKO12 261,330,618 *19833BAC9421EB5239136F04294C647271E4881A cody23231 261,330,619 *198FCF841511B3459AC990EB6C98BF10447E9A3D lukensinc 261,330,620 *1989C7585622750CC5D5909337FFC0168BDDAAFF COLIN.LATOURETTE 261,330,621 *1985E30203621BA3DB8C2FF2219F3C6591EEC001 COLLIN.SQUILLACE 261,330,622 *198E03B8A43F06D8949853D23C563F5CCA3A945D CPTU= 261,330,623 *1981267C1F75EA716ABE7CE09F468C4C7A875BF9 LYMANHAESE 261,330,624 *1984FD9A10273FA4B8E5AF047B6D74AEF7655AE7 ANTONIO-GARIBAY 261,330,625 *1988C9C9C88F53942BB078CC494E8773E1EA6D4D ANTONIO.JENNIGES 261,330,626 *198CA9FED9505AB16B5BCA4C521E1D4C0CAE191A LYNN-HINRICHS 261,330,627 *198DCFE27B921D58F091F6D65BE7F330499ED777 LYNWOODKORMANN 261,330,628 *19872E8F9A513CDF5D25A97B3D0EF64E6EF87765 cr$0 261,330,629 *198D8E313AC7D429D3CF736D8EF60A5180990970 CR,4W 261,330,630 *198756F84765222062F6B3840F4DAC1196D36A6E CORRECTEDGIVEN 261,330,631 *1981D25025E6235818E70AD86BF2C061DEADD8E0 CrFC 261,330,632 *19888A8AB2D4A720239877B9631D4E3271E1E0CC CORYSCIORTINO 261,330,633 *19863446E1483016BCC0930CC7001EA6D7C29A97 co,u- 261,330,634 *198E9038F95A63D86484929B8E6AE88637FBDC7E ap85c 261,330,635 *198380CD96379331DDACDD8A56C3F99DDB6D4C18 CROUPSESING 261,330,636 *1989EF6925715A8F23A65B1253487B939BE56A9F cpdvq 261,330,637 *1980752C290842AF682A78F797CF56F8DEF4E9FD makeitbeautiful 261,330,638 *198AB928F8D1E40B25176D4A7CA1465D4CED162F C:\PROGRAM.FILES\MICROSOFT.VISUAL.STUDIO.9.0\VC\VCWIZARDS\SMARTDEVICEAPPWIZ\MFC\APPLICATION\TEMPLATES\1031\ROOT.RC 261,330,639 *1986E831723DB9E6FAE1522C2537020510A62C70 CP$U0 261,330,640 *1987A9B3700BB7D2D94BC0FB7F0F84BCFAB9A76D MAMIANSUN 261,330,641 *19844D59C6FB177D065AFC882C75E85FDA144F7A cqq4k 261,330,642 *198D6DCC8488A8774A1588BBDA9188389B56CE3B MANDEL1 261,330,643 *198A215C50FCC68D7557FE6913EB0018C3718598 manowar.-.russian.tribute 261,330,644 *198782EC79E5705BF7AFDD577AE4A7BF6547A802 CRAZYPHUNKY4 261,330,645 *19812197D62C3AB549B934EC9AFCCC0F0C80D606 maohelenag@gzyp21net 261,330,646 *198AA37F5CD296199D666D4FBABA5F844318A8D5 cuqk 261,330,647 *198935255B0E50ED1E82ACC2A5616096E929E908 ARCHIERUTTINGER 261,330,648 *198EC90E8FE5ADFD0A93C4314DE708488427D234 MARCUS.BUSENBARK 261,330,649 *198281C8A1323CDF89815839071D40C8D4671519 Cv"j 261,330,650 *198B897DF5BEEC9BE0E421E7F490CA16CAA8A5A4 arkitsen 261,330,651 *198F3C405658231580649027F256B3CE249733A9 C/&S& 261,330,652 *1983BECFCFE7C4418D5A3EEA136901F8F6530010 cwgg@sinamailcom 261,330,653 *198B50341D682879936F75517F523CD335F76E52 ct1h8 261,330,654 *1984B1F18BA50C7DA50179C7AE39D132D862C357 markoldershaw 261,330,655 *198ABA47A0668AA8BBB5D53972F7DDC602B64663 CZO6R 261,330,656 *198EE43A20F040F31519F7A999E31880FCA06A38 ARYCHAN 261,330,657 *198AA13D20EBA996C3BD49B8733C62C2F58712B9 D;3? 261,330,658 *198DC1B36D6AC1CB8CD1C988759457C18154069D CvIb 261,330,659 *198C72166465568CB91991864B7BF26963DFBCC0 MATERIA_ 261,330,660 *1981A21054043DDC58460C9C9A6AADE9E1CEA53E cwlqv 261,330,661 *1985CF078A5A7867AE460D79894EA411B37C50F4 CXP@PUBLIC.GZ.CN 261,330,662 *198EA61F2E9A23BDF1DEC07F76B7AE95DE3076D2 ATMOSPHERIC-2 261,330,663 *198DB7D86FB1C0F36140167DD53A68DB6082DD9D AUGUSTINE.BAHAR 261,330,664 *19819EA2F40A9BDB79A6EC0E629CED5FFF5F8EC1 MEDIATIONGILAD 261,330,665 *198BD32DBBC42B4CEC3C352E533EB0A49F2E78D2 auhd) 261,330,666 *19898C0756C157C7322C7574EC426C4463B7BF3B D1$%W 261,330,667 *1987AE874B68D06D3FC01CAECECF9755D36886CF DAMIENGISMONDI 261,330,668 *198F890E481B6A329348980FE1E2E417967E791D DAMIONLOCK 261,330,669 *1982459C61AC1C231EB1C668BF6A61727F18FF9E DAN-CASTELLANETA 261,330,670 *19874D951E6EA2A19AD317DB752F93047AF1C00E MEMOIRIST@HUTCHCITY.COM 261,330,671 *1985BF113345C579309425EE26F69B3352774ED0 MEMORIESOFJANUARY 261,330,672 *198C53E15FD4F1B4093833EC827809E252FB3D0A DANIEL-COLLENS 261,330,673 *1983F4D0615A12CD307B5F714B035B48B8C5509C d4gao 261,330,674 *198119368864608C7909721A00DA825B5A06DBE7 D5K8B 261,330,675 *198EE15059000490F7FE368B107DB31519EA7873 d%6oh 261,330,676 *19810AEFCD154774258946C5DC21402F16096D72 m(<h 261,330,677 *19881EB191E72D657F4EB70642ACB2B53A4FFA8E MIA-FERNANDEZ 261,330,678 *19858E84438EB7EE2CB3350D93CA6C2DE5C2523A MICAHBERCHIELLI 261,330,679 *198FCB4971653A4B62DA51F235FA44C0C0DFD42B a;w;p 261,330,680 *198AD9D0992FE69B22E68B99B029085D2225DEF9 D8+LK 261,330,681 *198B3D8A502AD3D4AA2F1F02F2D692A42456BB7B azarette 261,330,682 *1986307563439FCF16A7D14592891FDBA0D92648 d!ae2 261,330,683 *198798E52E0096FD3CEA35B1FBA9FC23D5EFD152 MICHAL.MORSON 261,330,684 *198B4BD833530996AF67FFADA8824669A8F92864 michealgudmundson 261,330,685 *198A1E82EFEA46D8A7F45E33BDBBE76F6575B0DB MICKEY.BRADAC 261,330,686 *198CD8FE8DF2E0605698441DDC9A8BD6C0FD1728 DAMIANCOFFELT 261,330,687 *1988DA669079936924EED065B8260E7FFFE396AE dayanimini 261,330,688 *1982B2E0C3A7DC6C05D181D1169F4D1532A218FC DAMIEN.SCHMANDT 261,330,689 *198277C8541960E9ACE8E52BF8BB94A0B561D08B D+b& 261,330,690 *19823ABFE3BC36274A52618608A016819964C88B b1mu! 261,330,691 *198096FEB5589339DFC9A7AD4C334DEDA648ACA8 b3dti 261,330,692 *198872F8BF7397548B2ED81C386B229E31F43BEC B4BI8 261,330,693 *19882142B90E298C03051DA7D655D7546BBD81D7 dd7ip 261,330,694 *198A7D49D3EEA1B740E1F6C5E1384F9AB00288F5 MITZYDOG 261,330,695 *198C444D06D5238EA9503163F7C4E05BDB17F45E MMCEXPOCCTVCTWWEMWNEENUROIM 261,330,696 *1983072A02DDF5AB2B089A2D096EDECB5EE1B08A MODIFI48L3N3$$ 261,330,697 *198779D76110DF82ABBE248A6DB817156A34D91C DAVID.BIEHN 261,330,698 *1981F82B5A831FC53D9BF3E0FF61C00EB7FB1255 monogrammes9 261,330,699 *198BC4800BE2927B13C8CAAAA319140305C43668 MONOLOGU15+5 261,330,700 *198179BEA6673FDCF547331CA574A98715FA5715 BARRYDURHAN 261,330,701 *198E34AD72562B43CDE86EBA0BE2DBC8AD24FE59 BARRYYOHANNES 261,330,702 *19811113E3786DAC6EEAAFD57C408B037432C81A DEMOGRAPHY08364 261,330,703 *1987F277063259B9EF5BF5CB681E5EC40A1ED222 b"a/u 261,330,704 *198767038F1A709C773D637B2E5029A23A727D3C b(b6d 261,330,705 *19892415387703A021715A3A47836EDFA522C331 BBND 261,330,706 *198D03B2FABA0D555988350C1CF548C3BA09B03E MRSDAVISB 261,330,707 *19872AB32602A3CE26068C9355CEF20A06308617 MSINJAKU 261,330,708 *1983F17E62B278BFF9E0D0D46FB09C44D9C852F7 ddia4 261,330,709 *1980C3B87281B05F2BE66A447991938931C3294F multitiered 261,330,710 *1988EB7D012BF96A2A9D13F6BE8015D45116195C bcx?i 261,330,711 *198979F994DD688D45A6E317B27D7FC6C9C44A6B detaluci2 261,330,712 *198351965B838D1AE9CAB69EA2A109ABF8F162FC B?DKN 261,330,713 *19812133D0C2E92A390A65670CFFA2FA333F9956 DEANTSAKONAS 261,330,714 *19881F80C519C3E68F6950271C1BCFB2FB391AF9 BD%P= 261,330,715 *198E5C792E7458CF63A6A737BAB8C82E579DD2D1 DECRIALS 261,330,716 *198BBEA1D8316BEB55E7A807556DEA1B0DB4A7BB BEAUOGAZ 261,330,717 *1985B71D375BC730F0EF077EE10FA00B8297B1E8 B+EHN 261,330,718 *1987F130934BD69E61D11C2AF0C803B5F8E01CFA BELITTLING 261,330,719 *19878BE5EF5B70C2C89D0EAA25C0FB05C0AB5A76 DF!IE 261,330,720 *19859C9752BDC1C4040781F4C455F761629CADD2 MYWOLVES1986 261,330,721 *19808AB3E1EE48996789769FAA06F04BBAE81356 dgl+ 261,330,722 *198D0F75E66393C6B6676D666653A6D19CB44461 Dhishhnyamh 261,330,723 *1989B1D83297A9703FF982332E6A4DE524F348B6 DH,N7 261,330,724 *19862B2A7CE819A1CB81558E55DB70DBCAF402A0 DÉPÔTS 261,330,725 *198290AAC14B16E078C36177A1D0A8CCBA1E985D dericklangella 261,330,726 *198A5B79A2AADDF666CB94284E1466DE001F4C54 DICHTERLIEBE, OP 48: II AUS MEINEN TR 261,330,727 *198C11C80AA198865058E581FCB7243B9EF072BB desmondseary 261,330,728 *198AA116FF35CFC7ACDB36F9B013D29447074269 NASUSIM2 261,330,729 *1985CCBFFE8158C1B283CBB797E50978AA327D1B NATALIEFEHR 261,330,730 *1981427E53101B3EEAC8FC07E7EFF9842BB7C0E8 DIH-E 261,330,731 *19856E6B41EFEEEE907B8EB0FFAACCED87A54864 DION.BONNEVILLE 261,330,732 *198C644919224CFA13051A1CD3A4CD3A6C904AC3 NBVB1 261,330,733 *1989B51F149416C45B9305EDD81D91F44AB86211 df3dz 261,330,734 *198BDE2648B65C1AB06158D8BE0BE19575FA8321 discoverable! 261,330,735 *1983D2BD25BB19ADDD368A33C03FA2A5911169C7 DGFI& 261,330,736 *198745917453547A44F79EBD9DC7227E331B8E19 bi+gv 261,330,737 *1982C391577FBB0D8DB0F27002F5604B7A27DA10 DLGHE 261,330,738 *198D89E4825843179C082C602A02825F4E14AE6C DMLNJ 261,330,739 *19831DA94AF91064E73BBD60B5D7C8D428F7DD05 dmq( 261,330,740 *198AB2C2060C34812CA7E7893AD7C9CF5E8B2073 NICHOLAUSTHOMAS 261,330,741 *198B745688FBCEB41B4CBA7CD05D268D01C30A3D dnp4m 261,330,742 *1980E9AC38F5F992F721778BFDB523806CE429AA DIU;+ 261,330,743 *198409DFE90A2D8896DFFEDCE67DA44DD4D037AD DIVYA CHAWHAN 261,330,744 *1980BAC0905115FFD381EA770F7F6BA6D7E919A2 DOEFOOT、FETLAR 261,330,745 *19816B06DCB8128C1FF3518E7C63949D1F1B7458 njilpluh4 261,330,746 *198F0B2186E31B3A0D9F28DAE5C6980D42AAA7EA NNSTNNG6 261,330,747 *1981FE18FE32213D8CA696873E2AADB6921855B0 BlPU 261,330,748 *19843A390E11FAE1F906A7CD80958F6B52755CD4 DONGAMANDAP@YNETCOM 261,330,749 *198297E58489A7F57379F1073CD427EDC0F346DB NOE.ABBAS 261,330,750 *198A716D92EC8C10A414FF27EEDA9B1484E9971B DON-HODGDON 261,330,751 *198954AAE7004D0F269157BAE2ADC59D2A71677D NOMADISKAJĀM 261,330,752 *198C327ED5ECE54E1CF1FC2736722239A1BE34C6 dlkc2 261,330,753 *198CDF368B99BFC1382C9E3B1EB4358CC3806392 b"my( 261,330,754 *1988AA95E528241E6DF354B3DDBBF6518535869D DOPFAIRE4 261,330,755 *198B4768772FFBD3AD34FB8AF03B79A33572505E dos!f 261,330,756 *198A462C8D76D53D8E61B40A30341135A5F24B15 DMRBDLRW 261,330,757 *1980EE992277612B510E381873B93E1D6A13A6D2 DNAU5 261,330,758 *1982AAFC920BA9E1662538DD974BA211A0DFB19A DPB1( 261,330,759 *198F8A1FCE7185F7FACF21E5F428187547B1D74D DO4$? 261,330,760 *19860368E1E7A5A14C2471BD12B6E2A58E1D8568 BP-P: 261,330,761 *198BBF557FA4979250442838F25721D26AA5DC0E OARICA 261,330,762 *1986116D9FD559C551235D85F6C305F6D9F9C060 duanmarki@51com 261,330,763 *1982734205B533930FC504ADC3B4CBCEAAC68841 DUASESTRADAS 261,330,764 *1982DE1FD308C20A3BD29406CE58A8208E2DE504 BRAD YELTON 261,330,765 *198EE339BFDD941C3EA324BDCBEB2FFE961A36D8 brady-stowe 261,330,766 *19892CA89D949F888686982B43993162F91EED2E OF THE CORRESPONDING BITS IN THE OPERANDS IS 1. IN THE BITWISE 261,330,767 *1984F35E9FBC4C0942A31CF8B2E33C2A76496D0A DONNLESSLEY 261,330,768 *198CE5E19D9E3DBA72D615A13A993E7BAB4B064A durait4 261,330,769 *1989C495E067E2E60C579087AECC3156AFCEF7A3 DORSET It.toucheth.you,.my.lord,.as.much.as.me. 261,330,770 *198548BE2ADF26ECB2A5D9CDABED5246DE578D85 d=wcj 261,330,771 *1980B4F63CD66527E9DBD1B33EDCB1308257A45A DwWE 261,330,772 *198EC1FF6EFA4023293430BDE8DAC7E8852651EE dw,ym 261,330,773 *198F7C9D5B81F0118715C8F41A41E41289D580B5 DqrP 261,330,774 *19835618CF083A7DC779D5ED51E8DED7530138E4 D;(TJ 261,330,775 *1986A233EA34903B1EE5B78CF8EF45AAB0907B66 BUTCHANGEL 261,330,776 *1984D718BAEC6C7BE22574956C058384573CA359 EDISONHAYMORE 261,330,777 *1981A6426E9212192A918FC3605B427295720F00 dumisani-mashaba 261,330,778 *198A1E9296640FA8744D650FA161D2BB7415BB6D DUNNG 261,330,779 *198A519BD97D4511B1E1B6439CD7F0DDC8D93CC8 EDWARD.KAWAHARA 261,330,780 *19836B314E0B7848F8AABE9A996860A6D5BAB7CF B-YAR 261,330,781 *1981B358F1DE61E1EB7BCCB77CEF6871B4732F96 dvnd4 261,330,782 *198ADFD972465FBFDE92D91316A873EFBE38FB5D EHD)T 261,330,783 *19813C8A0DBD862343C341348812DB54897316CC C4P+I0USN3SS 261,330,784 *198E959FEAFE0343EFE749F03CBAB537C6CB906A EIM;N 261,330,785 *198DD7E6A5E8B02E7133E81E026183920D68E5E5 c6f0% 261,330,786 *1981EA302512414922CCF0895A9FF8BA2E396E30 c;a; 261,330,787 *19804FBCCD0497D04BFDE2BD08962699A9A62E6A dxst: 261,330,788 *198C47EB27FD4B9688D061742C3281BA0803A55F ELMÉRIENS 261,330,789 *19849273490C95F810DDA891EDEB5AE93E80B8E9 ELUCUBRATED 261,330,790 *198CD8C6061B8993DBC17A5CC4DC5A799D07C92D CANE MI11 261,330,791 *1985911AE20DDBEE8BD728077ACC639A454B9DEC P4UL4TIF 261,330,792 *19811BEAC74602400EAC3CC816B49BC98F8F6538 carla.quadros 261,330,793 *19899C846ACE8A59D7662978F21C95FA4EBBD4FF DZUBCO 261,330,794 *198046D891740C3A058EDB738EC9650949598043 CARMEN.GHOLAR 261,330,795 *1983476814D05D4F7021756F55A42AE8A202053D CARROCHAS5 261,330,796 *19853C9DB68D6A30FCB3E6C51198ECD679DCC2FF earlemendler 261,330,797 *198C423AA72F26B61E9AE2B638FD220ED60906ED PAM-CALLAWAY 261,330,798 *198615D7B3CA8DF2E13D47AA484F121A69A01B9B emilkisro 261,330,799 *198D940CA994C10DF25ADB633775FBFD95ACAE71 emmanuelle(feat.laurentdury) 261,330,800 *19822E80FE8D0CF2C43F1B5E4456EDBBDD2C232E EATMERUY2 261,330,801 *198BA41D3C19C3BFCF547A8473516AFD4FAEBE61 en21215248168 261,330,802 *19871D9EE791D0E49ABB248661521648E1EF91D6 EBMET 261,330,803 *198DDF0A8996D22385B57FEF686DD82F8A22D2A7 E.P.2-Equality 261,330,804 *1988CD2340327EFDDDF6C1D9E087BB16C7226472 EDDIECAGNON 261,330,805 *1988D5A02903177C92C7E1425A14F91F37DC8DDE eddieyorio 261,330,806 *198E7C8B04330E8D77E6FE2A97DCEF2B6623904B parnorpine@hutchcitycom 261,330,807 *1986AC18299AC4034DD7115D748FDD5CF8E52966 ERICH.LASSERRE 261,330,808 *198586E4F743DCBDC7EE7B0D343EC38472C8A124 ERICKLESSIG 261,330,809 *1985B658E14B0C960D4FBEC72799029D5C5EFDC3 EDIFICIOS.RELIGIOSOS.EN.MARRUECOS 261,330,810 *19831C8018687E381EE8F468B79CA72B91F54DD0 edlednahs 261,330,811 *19805B40A7F17F9CBB184B3387EA5098C936A793 EDUARDO.MARKUNAS 261,330,812 *198C8D511F55672E9F4C9639DBCECB3604927E55 eduardonickson 261,330,813 *1989775D7B9FD7C42890FE6FC4E20BFE68A1AD4A edulretns 261,330,814 *198B72E587FB02A5B460978F975B9BDAA12851C6 C.AUK 261,330,815 *198DB54BDF9DB0C4F4951E674B27A108ED6925E2 EEH6K 261,330,816 *19809148D59EF5BA683FE9F06BC98B7122DE0BDE EENNARAV0 261,330,817 *198B195708EA2B8393FDB0F0243A872D5322B5F5 cb)pb 261,330,818 *198C3F423BA1EC754F77DC2990E0E40A2AA956FC PBWTOOLS3 261,330,819 *198264BAF15ABC7ADD8B397738836A2FFB438DA8 pcapmarina 261,330,820 *1984A3BBBC60037F61B30FAE68F8B6B8030616EE CCMLP 261,330,821 *198A46C8AB7288D846587F8B24921324EC088ED6 CCYFP 261,330,822 *198F21DF3C190DF70BFD93C08EC15CC1D34EAD1A cellone@cavcommcom 261,330,823 *198F1E69EA7F0F0DFD28D27022CFD78982161185 cepub@yeahnet 261,330,824 *198D76429F6333E81E1A69F219969FD074690BAF CEREN.AKSOY 261,330,825 *1988CE3FD20012F756EE24274AF7126A38F70AC4 c/f! 261,330,826 *198D8A5F05B38CB196DFF9A4897DA4BC8B614577 PETROLOOCK 261,330,827 *198ED06D686592DC6E9D1515CA6EE477E0B68D40 ELJY5592 261,330,828 *1980FF5A583A1F42574507809731DF126506939E PHOTOEMITTER0 261,330,829 *1986DA388D61EDA591DEAA1781D3AA3F7B5AC9D9 C%GN 261,330,830 *19888BDF09FC1312B41F8936CEDC8FBA2B0E65D9 elmerwieseman 261,330,831 *19806C3BF617AC086A72846A75474FDEAA7B3107 ELONKAUPALLAAN 261,330,832 *198EB10406AACBCB47B86D51FDDD608AB489752B CH1PEPRS 261,330,833 *198F7282ABAA1A30FF66DCCF45EB3CB3C3034A7E fa, 261,330,834 *19893B03A31CC081DD8EC6032EDD77B7F9ABC4D1 emilebailony 261,330,835 *198E09434CC04C3B7EA7E7EB4325410870725AE6 FABELACHTIGER 261,330,836 *1987FBC5CFE9CCFDFFE7ABFAA70BAE365EBEB757 CHAPTER.0604:.GILDEROY.LOCKHART 261,330,837 *198AE573DFA46AB489B5A70CA9D73B7C4C6082DB chapter.15.-.the.unbreakable.vow_26 261,330,838 *198BD713D9F60E9DD9F38002D6EE9F054EAA3B29 faut--bravo 261,330,839 *198BD0EEAAB00AD0871203AE851C9F4D04A55E79 CHASSAUREY 261,330,840 *1981A50FFBE6AD8D33E4C4454DF37D4190BB04B0 PODÁVANÝMI 261,330,841 *1980965CFAB9903E8388B73F716C9318A51E95C3 federicocartrette 261,330,842 *1980856270FD47A0F92B02961E95F719EA97DE3D FEDERICO.CRAMBLIT 261,330,843 *19867F505CBA8351066D3F0491BA2CE62E774029 poiuytrepoi 261,330,844 *19881B9E2F65601FB549F7A4AE3895E0D5D217C3 FENGJOANE@ZJONLINECOMCN 261,330,845 *198AA02CDF940E42C622442D19C6C9